Stem-loop sequence tni-mir-214

AccessionMI0003357 (change log)
DescriptionTetraodon nigroviridis miR-214 stem-loop
Gene family MIPF0000062; mir-214
Stem-loop
   ---------  g  g             aca            accu 
5'          gu gu ugucugccugucu   cuugcugugcag    u
            || || |||||||||||||   ||||||||||||    c
3'          cg ua acagacggacaga   ggacgacauguc    u
   ucaccccga  g  g             cac            cucg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This Tetraodon miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (Tetraodon8) Overlapping transcripts
1: 12449346-12449433 [+]
sense
ENSTNIT00000023465 ; tni-mir-214-201; exon 1
Database links

Mature sequence tni-miR-214

Accession MIMAT0003027
Sequence

50 - 

acagcaggcacagacaggcag

 - 70

Get sequence
Evidence by similarity; MI0001381