Stem-loop hsa-mir-510

Accession

MI0003197

Symbol

HGNC: MIR510

Description

Homo sapiens hsa-mir-510 precursor miRNA

Gene family

MIPF0000130; mir-506

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR510 is a microRNA that is largely unexplored in terms of its molecular functions [PMC8441705]. It is one of the 35 candidate genes that have differential methylation sites in the promoter region [PMC8441705]. In wheat, MIR510 is one of the 58 miRNAs discovered through sequencing, and it belongs to the group of 23 novel miRNAs [PMC5360763]. A SNP (G/A) in the stem region of MIR510 has been found to enhance the production of mature miRNA [PMC7113310]. However, targets for MIR510 and other new miRNAs have been difficult to predict due to limited wheat EST sequences available in databases [PMC2394755]. In breast cancer, MIR510 has been proposed as a tumor growth promoting oncomiR that binds to PRDX I 3'UTR [PMC5362709]. High levels of MIR510 expression have been associated with a dismal relapse-free survival (RFS) rate in patients with breast cancer, particularly when related to CD30 protein expression [PMC5362709]. Additionally, MIR510 has been shown to be upregulated in Tregs from individuals with type 1 diabetes (T1D) [PMC7731293]. A deletion on Xq27.3 encompassing several genes and miRNAs including MIR510 has been observed in individuals with fragile X syndrome and other related disorders [PMC9130735]. Furthermore, point mutations have been identified in the mature coding region of MIR510 as well as other miRNAs associated with depression and other psychiatric disorders [PMC2699475][PM4883715[PM4883715].

Literature search

15 open access papers mention hsa-mir-510
(144 sentences)

Sequence

1421 reads, 98 reads per million, 25 experiments

gugguguccUACUCAGGAGAGUGGCAAUCACauguaauuaggugugAUUGAAACCUCUAAGAGUGGAguaacac
(((...(((.((((.((((.((..(((((((((........)))))))))..))))))..)))))))....)))

Structure

   -gug   U    -A    A  GG         gua 
gug    ucc ACUC  GGAG GU  CAAUCACau   a
|||    ||| ||||  |||| ||  |||||||||    
cac    AGG UGAG  UCUC CA  GUUAgugug   u
   aaug   -    AA    -  AA         gau 

Annotation confidence High

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context

chrX: 147272335-147272408 [-]

Clustered miRNAs

2 other miRNAs are < 10 kb from hsa-mir-510

Disease association

hsa-mir-510 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-510-5p

• Accession: MIMAT0002882
• Description: Homo sapiens hsa-miR-510-5p mature miRNA
• Sequence: 10 - UACUCAGGAGAGUGGCAAUCAC - 31
• Evidence: experimental ; array-cloned [1], cloned [2], Illumina [3]

Mature hsa-miR-510-3p

• Accession: MIMAT0026613
• Description: Homo sapiens hsa-miR-510-3p mature miRNA
• Sequence: 47 - AUUGAAACCUCUAAGAGUGGA - 67
• Evidence: experimental ; Illumina [3]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 15965474
   Identification of hundreds of conserved and nonconserved human microRNAs
   "Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z"
   "Nat Genet (2005) 37:766-770


3. PubMed ID: 23034410
   Birth and expression evolution of mammalian microRNA genes
   "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
   "Genome Res (2013) 23:34-45