miRBase entry: hsa-mir-509-1

Stem-loop hsa-mir-509-1


Accession
MI0003196
Symbol
HGNC: MIR509-1
Description
Homo sapiens hsa-mir-509-1 precursor miRNA
Gene family
MIPF0000130; mir-506

Literature search
31 open access papers mention hsa-mir-509-1
(221 sentences)

Sequence

51808 reads, 1214 reads per million, 43 experiments
caugcugugugugguacccUACUGCAGACAGUGGCAAUCAuguauaauuaaaaaUGAUUGGUACGUCUGUGGGUAGaguacugcaugacacaug
((((.((((((((((((.(((((((((((.(((.(((((((............))))))).))))))))).))))).))))))))).)))))))

Structure
    c   -         c     -      A   G       guaua 
caug ugu gugugguac cUACU GCAGAC GUG CAAUCAu     a
|||| ||| ||||||||| ||||| |||||| ||| |||||||      
guac aca uacgucaug GAUGG UGUCUG CAU GUUAGUa     u
    -   g         a     G      -   G       aaaau 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The cloned miR-509-5p sequence from [3] includes a 1 nt extension at the 3' end (A), which is incompatible with the genome sequence.

Genome context
chrX: 147260532-147260625 [-]
Clustered miRNAs
2 other miRNAs are < 10 kb from hsa-mir-509-1
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-509-1 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-509-5p

Accession MIMAT0004779
Description Homo sapiens hsa-miR-509-5p mature miRNA
Sequence 20 - UACUGCAGACAGUGGCAAUCA - 40
Evidence experimental
cloned [3]
Database links
Predicted targets

Mature hsa-miR-509-3p

Accession MIMAT0002881
Description Homo sapiens hsa-miR-509-3p mature miRNA
Sequence 55 - UGAUUGGUACGUCUGUGGGUAG - 76
Evidence experimental
array-cloned [1], cloned [2-3]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 15965474
    Identification of hundreds of conserved and nonconserved human microRNAs
    "Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z"
    "Nat Genet (2005) 37:766-770

  3. PubMed ID: 17573847
    Analysis of gene expression in normal and neoplastic human testis: new roles of RNA
    "Novotny GW, Nielsen JE, Sonne SB, Skakkebaek NE, Rajpert-De Meyts E, Leffers H"
    "Int J Androl (2007) 30:316-326