Stem-loop sequence hsa-mir-518a-1

Accession

MI0003170 (change log)

Symbol

HGNC:MIR518A1

Description

Homo sapiens miR-518a-1 stem-loop

Gene family

MIPF0000020; mir-515

Literature search

9 open access papers mention hsa-mir-518a-1
(13 sentences)

Stem-loop

                -  -            c      g  g c 
5' ucucaagcuguga cu gcaaagggaagc cuuucu uu u u
   ||||||||||||| || |||||||||||| |||||| || | g
3' agaguuuggcauu gg cguuucccuucg gaaaga aa a a
                a  u            c      g  g a 

Deep sequencing

98 reads, 0 reads per million, 33 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

The 5' mature product was previously named miR-527 in [1] and here. Landgraf et al. showed that products from both arms are approximately equally expressed [2]. miR-527 is renamed miR-518a-5p here. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations. miR-518a-5p cloned in [2] has a 1 nt 3' extension (A), which is incompatible with the genome sequence.

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr19: 53731006-53731090 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from hsa-mir-518a-1

• hsa-mir-517b: chr19: 53721076-53721142 [+]
• hsa-mir-520g: chr19: 53722166-53722255 [+]
• hsa-mir-516b-2: chr19: 53725442-53725526 [+]
• hsa-mir-526a-2: chr19: 53726922-53726986 [+]
• hsa-mir-518e: chr19: 53729838-53729925 [+]
• hsa-mir-518a-1: chr19: 53731006-53731090 [+]
• hsa-mir-518d: chr19: 53734877-53734963 [+]
• hsa-mir-516b-1: chr19: 53736845-53736934 [+]
• hsa-mir-518a-2: chr19: 53739333-53739419 [+]

Database links

• EntrezGene:MIR518A1
• HGNC:MIR518A1
• RNAcentral:URS0000724CB9_9606
• miRBase Tracker:MI0003170

Mature sequence hsa-miR-518a-5p

• Accession: MIMAT0005457
• Sequence: 14 - cugcaaagggaagcccuuuc - 33
• Deep sequencing: 82 reads, 11 experiments
• Evidence: experimental; array-cloned [1]
• Predicted targets:
  • TargetMiner:hsa-miR-518a-5p
  • TargetScanVert:hsa-miR-518a-5p
  • miRDB:hsa-miR-518a-5p
  • microrna.org:hsa-miR-518a-5p

Mature sequence hsa-miR-518a-3p

• Accession: MIMAT0002863
• Previous IDs: hsa-miR-518a
• Sequence: 51 - gaaagcgcuucccuuugcugga - 72
• Deep sequencing: 100 reads, 23 experiments
• Evidence: experimental; array-cloned [1], cloned [2]
• Database links:
  • RNAcentral:URS0000024ACC_9606
• Predicted targets:
  • TargetMiner:hsa-miR-518a-3p
  • TargetScanVert:hsa-miR-518a-3p
  • miRDB:hsa-miR-518a-3p
  • microrna.org:hsa-miR-518a-3p

References

1. PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).