Hsa-mir-518e is a miRNA that has been found to be upregulated in pancreatic ductal adenocarcinoma (PDAC) tissues compared to adjacent normal controls [PMC5649611]. It is one of the 12 miRNAs that are upregulated in PDAC tissues, along with hsa-miR-10b, hsa-miR-575, hsa-miR-159a, hsa-miR-644, hsa-miR-581, hsa-miR-637, hsa-miR-935, hsa-miR-98, hsa-miR-513-3p, hsa-mir-518e (hsa) [PMC5649611]. Additionally, it has been found to be significantly dysregulated in 9 comparisons [PMC4268797]. In a study comparing neural stem cells (NSC) and induced pluripotent stem cells (iPSC), the expression of hsa-mir-518e was highly decreased in NSC cells compared to iPSC [PMC6696086]. This suggests that it may be a negative regulator of neural differentiation from iPSC [PMC6696086]. Furthermore, it has been identified as one of the miRNAs characteristic for the transition from iPSC to NSC along with other miRNAs such as mir-302 family and let7 family [PMC6696086]. In hepatocellular carcinoma (HCC), both hsa-mir518e and its homologue hsa-mir518b have been found to be upregulated [PMC5937522].
- ug c A Guuggc ucucag gc ugac CUCU GAGGGAAGCGCUUUCU u |||||| || |||| |||| |||||||||||||||| a agaguu cg auuG GAGA UUCCCUUCGCGAAAga a u ca U C aaagaa
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0005450 |
Description | Homo sapiens hsa-miR-518e-5p mature miRNA |
Sequence | 16 - CUCUAGAGGGAAGCGCUUUCUG - 37 |
Evidence |
experimental
array-cloned [1], cloned [2] |
Database links | |
Predicted targets |
Accession | MIMAT0002861 |
Description | Homo sapiens hsa-miR-518e-3p mature miRNA |
Sequence | 54 - AAAGCGCUUCCCUUCAGAGUG - 74 |
Evidence |
experimental
array-cloned [1], cloned [2] |
|