miRBase entry: hsa-mir-523

Stem-loop hsa-mir-523


Accession
MI0003153
Symbol
HGNC: MIR523
Description
Homo sapiens hsa-mir-523 precursor miRNA
Gene family
MIPF0000020; mir-515

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR523 is a miRNA gene that is part of the C19MC miRNA gene cluster on chromosome 19 [PMC6193703]. In breast invasive carcinoma, the expression of MIR523 was not significantly different between the CAA and control groups when using a variable threshold, but became significantly different when using a fixed threshold [PMC7157974]. Additionally, MIR523 was close to being significantly different in other analyses [PMC7157974]. However, the targets for MIR523 and other miRNAs in the C19MC cluster could not be predicted due to limited available sequences in databases [PMC2394755]. In hepatocellular carcinoma (HCC), the expression of MIR523 and other C19MC miRNA genes was analyzed using TCGA miRNA-seq dataset and matched to HCC-iCluster RNA-seq data set to create an integrated dataset [PMC7378193]. Furthermore, MIR523 is part of a subset of miRNAs on chromosome 19 that have been associated with stem cell biology and tumorigenesis [PMC8508841].

References:
- [PMC6193703]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6193703/
- [PMC7157974]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7157974/
- [PMC2394755]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2394755/
- [PMC7378193]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7378193/
- [PM8508841]: https://www.ncbi.nlm.nih.gov/pmc/articles/PM8508841/

Literature search
4 open access papers mention hsa-mir-523
(10 sentences)

Sequence

107 reads, 16 reads per million, 19 experiments
ucucaugcugugaccCUCUAGAGGGAAGCGCUUUCUGuugucugaaagaaaaGAACGCGCUUCCCUAUAGAGGGUuacccuuugaga
(((((....(((((((((((.((((((((((.((((....(((...)))..)))).)))))))))).)))))))))))....)))))

Structure
     ugcu           G          U    Guug   g 
ucuca    gugaccCUCUA AGGGAAGCGC UUCU    ucu  
|||||    ||||||||||| |||||||||| ||||    ||| a
agagu    cauUGGGAGAU UCCCUUCGCG AAGa    aga  
     uucc           A          C    --aa   a 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr19: 53698385-53698471 [+]
Clustered miRNAs
10 other miRNAs are < 10 kb from hsa-mir-523
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-523 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-523-5p

Accession MIMAT0005449
Description Homo sapiens hsa-miR-523-5p mature miRNA
Sequence 16 - CUCUAGAGGGAAGCGCUUUCUG - 37
Evidence experimental
array-cloned [1], cloned [2]
Database links
Predicted targets

Mature hsa-miR-523-3p

Accession MIMAT0002840
Description Homo sapiens hsa-miR-523-3p mature miRNA
Sequence 53 - GAACGCGCUUCCCUAUAGAGGGU - 75
Evidence experimental
array-cloned [1], cloned [2]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 15965474
    Identification of hundreds of conserved and nonconserved human microRNAs
    "Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z"
    "Nat Genet (2005) 37:766-770