Stem-loop sequence hsa-mir-519c

Accession

MI0003148 (change log)

Symbol

HGNC:MIR519C

Description

Homo sapiens miR-519c stem-loop

Gene family

MIPF0000020; mir-515

Literature search

27 open access papers mention hsa-mir-519c
(69 sentences)

Stem-loop

         c      c            a         guug  u 
5' ucucag cuguga ccucuagaggga gcgcuuucu    uc g
   |||||| |||||| |||||||||||| |||||||||    || a
3' agaguu gacauu ggagauuuuucu cgugaaaga    ag a
         u      a            a         --aa  a 

Deep sequencing

733 reads, 14.8 reads per million, 88 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

The 5' arm of this precursor expresses a product related to miR-526 (previously named miR-526c here). Landgraf et al. confirm mature miRNA expression from both arms of the precursor [2], leading to the -5p, -3p designations. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr19: 53686469-53686555 [+]
• Overlapping transcripts:

  antisense

  OTTHUMT00000464179 ; ZNF665-002; intron 1

  OTTHUMT00000464180 ; ZNF665-001; intron 1

  OTTHUMT00000464181 ; ZNF665-005; intron 1

  OTTHUMT00000464183 ; ZNF665-003; intron 1

  OTTHUMT00000464182 ; ZNF665-004; intron 3

  ENST00000600412 ; ZNF665-002; intron 1

  ENST00000396424 ; ZNF665-001; intron 1

  ENST00000597544 ; ZNF665-005; intron 1

  ENST00000598440 ; ZNF665-003; intron 1

  ENST00000596373 ; ZNF665-004; intron 3

Clustered miRNAs

< 10kb from hsa-mir-519c

• hsa-mir-515-1: chr19: 53679003-53679085 [+]
• hsa-mir-519e: chr19: 53679940-53680023 [+]
• hsa-mir-520f: chr19: 53682159-53682245 [+]
• hsa-mir-515-2: chr19: 53685009-53685091 [+]
• hsa-mir-519c: chr19: 53686469-53686555 [+]
• hsa-mir-1283-1: chr19: 53688481-53688567 [+]
• hsa-mir-520a: chr19: 53690881-53690965 [+]
• hsa-mir-526b: chr19: 53694393-53694475 [+]
• hsa-mir-519b: chr19: 53695213-53695293 [+]

Database links

• EntrezGene:MIR519C
• HGNC:MIR519C
• RNAcentral:URS00006D6710_9606
• miRBase Tracker:MI0003148

Mature sequence hsa-miR-519c-5p

• Accession: MIMAT0002831
• Previous IDs: hsa-miR-526c
• Sequence: 16 - cucuagagggaagcgcuuucug - 37
• Deep sequencing: 509 reads, 49 experiments
• Evidence: experimental; array-cloned [1], cloned [2]
• Database links:
  • RNAcentral:URS00005ECFE5_9606
• Predicted targets:
  • TargetMiner:hsa-miR-519c-5p
  • TargetScanVert:hsa-miR-519c-5p
  • miRDB:hsa-miR-519c-5p
  • microrna.org:hsa-miR-519c-5p

Mature sequence hsa-miR-519c-3p

• Accession: MIMAT0002832
• Previous IDs: hsa-miR-519c
• Sequence: 54 - aaagugcaucuuuuuagaggau - 75
• Deep sequencing: 210 reads, 51 experiments
• Evidence: experimental; array-cloned [1]
• Predicted targets:
  • TargetMiner:hsa-miR-519c-3p
  • TargetScanVert:hsa-miR-519c-3p
  • miRDB:hsa-miR-519c-3p
  • microrna.org:hsa-miR-519c-3p

References

1. PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).