![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-520f |
||||||||||||||||||||
Accession | MI0003146 (change log) | |||||||||||||||||||
Symbol | HGNC:MIR520F | |||||||||||||||||||
Description | Homo sapiens miR-520f stem-loop | |||||||||||||||||||
Gene family | MIPF0000020; mir-515 | |||||||||||||||||||
Literature search |
![]()
36 open access papers mention hsa-mir-520f | |||||||||||||||||||
Stem-loop |
u u gugg a 5' ucucaggc gugacccucuaaagggaagcgcuu cu uc g |||||||| |||||||||||||||||||||||| || || a 3' aggguuug cauugggagauuuuccuucgugaa ga ag a c c --aa a |
|||||||||||||||||||
Deep sequencing |
| |||||||||||||||||||
Confidence |
Annotation confidence: not enough data
| |||||||||||||||||||
Genome context |
|
|||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||
Database links |
|
Mature sequence hsa-miR-520f-5p |
|
Accession | MIMAT0026609 |
Sequence |
15 - ccucuaaagggaagcgcuuucu - 36 |
Deep sequencing | 150 reads, 24 experiments |
Evidence | experimental; Illumina [2] |
Predicted targets |
|
Mature sequence hsa-miR-520f-3p |
|
Accession | MIMAT0002830 |
Sequence |
55 - aagugcuuccuuuuagaggguu - 76 |
Deep sequencing | 490 reads, 48 experiments |
Evidence | experimental; array-cloned [1], Illumina [2] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:15965474
"Identification of hundreds of conserved and nonconserved human microRNAs"
Nat Genet. 37:766-770(2005).
|
2 |
PMID:23034410
"Birth and expression evolution of mammalian microRNA genes"
Genome Res. 23:34-45(2013).
|