![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-515-1 |
||||||||||||||||||||||
Accession | MI0003144 (change log) | |||||||||||||||||||||
Symbol | HGNC:MIR515-1 | |||||||||||||||||||||
Description | Homo sapiens miR-515-1 stem-loop | |||||||||||||||||||||
Gene family | MIPF0000020; mir-515 | |||||||||||||||||||||
Literature search |
![]()
36 open access papers mention hsa-mir-515-1 | |||||||||||||||||||||
Stem-loop |
u c u a uu gu 5' ucuca gcagu au cuccaaaagaa gcac ucuguu c ||||| ||||| || ||||||||||| |||| |||||| u 3' agagu uguca ug gagguuuucuu cgug agacga g u u c c -- aa |
|||||||||||||||||||||
Deep sequencing |
| |||||||||||||||||||||
Confidence |
Annotation confidence: not enough data
| |||||||||||||||||||||
Comments |
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. |
|||||||||||||||||||||
Genome context |
|
|||||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||||
Database links |
|
Mature sequence hsa-miR-515-5p |
|
Accession | MIMAT0002826 |
Sequence |
14 - uucuccaaaagaaagcacuuucug - 37 |
Deep sequencing | 282 reads, 50 experiments |
Evidence | experimental; array-cloned [1], cloned [2] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-515-3p |
|
Accession | MIMAT0002827 |
Sequence |
51 - gagugccuucuuuuggagcguu - 72 |
Deep sequencing | 64 reads, 19 experiments |
Evidence | experimental; array-cloned [1], cloned [2] |
Predicted targets |
|
References |
|
1 |
PMID:15965474
"Identification of hundreds of conserved and nonconserved human microRNAs"
Nat Genet. 37:766-770(2005).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|