![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-512-2 |
||||||||||||||
Accession | MI0003141 (change log) | |||||||||||||
Symbol | HGNC:MIR512-2 | |||||||||||||
Description | Homo sapiens miR-512-2 stem-loop | |||||||||||||
Gene family | MIPF0000130; mir-506 | |||||||||||||
Literature search |
![]()
42 open access papers mention hsa-mir-512-2 | |||||||||||||
Stem-loop |
a -- ug ca cu g ---- g 5' ggu cuu cucaguc ugg cucagc uga ggcacuu ucug u ||| ||| ||||||| ||| |||||| ||| ||||||| |||| 3' cca gag gagucag acc gagucg acu ucgugaa agac g c cg ua ug au g agua c |
|||||||||||||
Deep sequencing |
| |||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||
Genome context |
|
|||||||||||||
Clustered miRNAs |
|
|||||||||||||
Database links |
|
Mature sequence hsa-miR-512-5p |
|
Accession | MIMAT0002822 |
Sequence |
20 - cacucagccuugagggcacuuuc - 42 |
Deep sequencing | 126 reads, 20 experiments |
Evidence | experimental; array-cloned [1] |
Predicted targets |
|
Mature sequence hsa-miR-512-3p |
|
Accession | MIMAT0002823 |
Sequence |
57 - aagugcugucauagcugagguc - 78 |
Deep sequencing | 562 reads, 28 experiments |
Evidence | experimental; array-cloned [1], cloned [2] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:15965474
"Identification of hundreds of conserved and nonconserved human microRNAs"
Nat Genet. 37:766-770(2005).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|