![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-490 |
|||||
Accession | MI0003125 (change log) | ||||
Symbol | HGNC:MIR490 | ||||
Description | Homo sapiens miR-490 stem-loop | ||||
Gene family | MIPF0000229; mir-490 | ||||
Literature search |
![]()
34 open access papers mention hsa-mir-490 | ||||
Stem-loop |
u -cc g - aguucauu c -- g caa u 5' ggagg uugcug uuug gaa guucgaca caugga ucuccaggu ggu guu a ||||| |||||| |||| ||| |||||||| |||||| ||||||||| ||| ||| 3' ccuuc ggcgac gaac cuu cgaguugu guaccu ggaggucca cca uag g a aca - a ------gu c ca a -cg a |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-490-5p |
|
Accession | MIMAT0004764 |
Sequence |
39 - ccauggaucuccaggugggu - 58 |
Deep sequencing | 422 reads, 32 experiments |
Evidence | experimental; cloned [2-3] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-490-3p |
|
Accession | MIMAT0002806 |
Previous IDs | hsa-miR-490 |
Sequence |
76 - caaccuggaggacuccaugcug - 97 |
Deep sequencing | 981 reads, 48 experiments |
Evidence | experimental; array-cloned [1] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:15965474
"Identification of hundreds of conserved and nonconserved human microRNAs"
Nat Genet. 37:766-770(2005).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
3 |
PMID:18230126
"New miRNAs cloned from neuroblastoma"
BMC Genomics. 9:52(2008).
|