Stem-loop sequence lca-mir-92-2

AccessionMI0003106 (change log)
DescriptionLemur catta miR-92-2 stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
     a    ug   g     uu  u   u     guguu 
5' uc uccg  ggu gggau  gu gca uacuu     a
   || ||||  ||| |||||  || ||| |||||      
3' ag aggu  ccg cccug  ca cgu augaa     u
     a    gu   g     uu  -   u     augua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Database links

Mature sequence lca-miR-92

Accession MIMAT0002671
Sequence

48 - 

uauugcacuugucccggccugu

 - 69

Get sequence
Evidence by similarity; MI0000094

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).