Stem-loop sequence mne-mir-96

AccessionMI0003093 (change log)
DescriptionMacaca nemestrina miR-96 stem-loop
Gene family MIPF0000072; mir-96
Stem-loop 
   ugg  g  u        a      uu      ---   uc 
5'    cc au uuggcacu gcacau  uugcuu   gug  u
      || || |||||||| ||||||  ||||||   |||   
3'    gg ua aaccguga cgugua  aacgag   cgc  c
   aaa  g  u        -      cu      ucu   cu
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Database links

Mature sequence mne-miR-96

Accession MIMAT0002792
Sequence

9 -  

uuuggcacuagcacauuuuugc

 - 30

Get sequence
Evidence by similarity; MI0000098

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).