![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mne-mir-96 |
|
Accession | MI0003093 (change log) |
Description | Macaca nemestrina miR-96 stem-loop |
Gene family | MIPF0000072; mir-96 |
Stem-loop |
ugg g u a uu --- uc 5' cc au uuggcacu gcacau uugcuu gug u || || |||||||| |||||| |||||| ||| 3' gg ua aaccguga cgugua aacgag cgc c aaa g u - cu ucu cu |
Confidence |
Annotation confidence: not enough data
|
Comments |
Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated. |
Database links |
|
Mature sequence mne-miR-96 |
|
Accession | MIMAT0002792 |
Sequence |
9 - uuuggcacuagcacauuuuugc - 30 |
Evidence | by similarity; MI0000098 |
References |
|
1 |
PMID:15652478
"Phylogenetic shadowing and computational identification of human microRNA genes"
Cell. 120:21-24(2005).
|