Stem-loop sequence mne-mir-183

AccessionMI0003092 (change log)
DescriptionMacaca nemestrina miR-183 stem-loop
Gene family MIPF0000066; mir-183
Stem-loop
   ccgcagaa    ac  -----         g      --ac     ga        --   ac 
5'         cgug  uc     cuguucugu uauggc    uggua  auucacug  uga  a
           ||||  ||     ||||||||| ||||||    |||||  ||||||||  |||   
3'         gcac  ag     gacgagaca auaccg    gccau  uaagugac  gcu  g
   -------a    cu  acaga         a      ggaa     --        ug   cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Database links

Mature sequence mne-miR-183

Accession MIMAT0002791
Sequence

27 - 

uauggcacugguagaauucacug

 - 49

Get sequence
Evidence by similarity; MI0000273

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).