Stem-loop sequence mne-mir-24-2

AccessionMI0003058 (change log)
DescriptionMacaca nemestrina miR-24-2 stem-loop
Gene family MIPF0000041; mir-24
Stem-loop
   cucugcc   c  g   a         aaca    ug  u 
5'        ucc gu ccu cugagcuga    cagu  gu u
          ||| || ||| |||||||||    ||||  ||  
3'        agg ca gga gacuugacu    guca  cg g
   -------   a  a   c         --cg    ca  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Database links

Mature sequence mne-miR-24-3p

Accession MIMAT0002341
Previous IDsmne-miR-24
Sequence

50 - 

uggcucaguucagcaggaacag

 - 71

Get sequence
Evidence by similarity; MI0000081

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).