![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mne-mir-27a |
|
Accession | MI0003057 (change log) |
Description | Macaca nemestrina miR-27a stem-loop |
Gene family | MIPF0000036; mir-27 |
Stem-loop |
a -a a ug u g u cac 5' cug gg gc gggcuuagc cu gugagca gg c a ||| || || ||||||||| || ||||||| || | 3' gac cc cg cuugaaucg ga cacuugu cu g c c cc c gu - g - aac |
Confidence |
Annotation confidence: not enough data
|
Comments |
Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated. |
Database links |
|
Mature sequence mne-miR-27a |
|
Accession | MIMAT0002757 |
Sequence |
51 - uucacaguggcuaaguuccgcc - 72 |
Evidence | by similarity; MI0000085 |
References |
|
1 |
PMID:15652478
"Phylogenetic shadowing and computational identification of human microRNA genes"
Cell. 120:21-24(2005).
|