Stem-loop sequence mne-mir-27a

AccessionMI0003057 (change log)
DescriptionMacaca nemestrina miR-27a stem-loop
Gene family MIPF0000036; mir-27
Stem-loop
      a  -a  a         ug  u       g  u cac 
5' cug gg  gc gggcuuagc  cu gugagca gg c   a
   ||| ||  || |||||||||  || ||||||| || |    
3' gac cc  cg cuugaaucg  ga cacuugu cu g   c
      c  cc  c         gu  -       g  - aac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Database links

Mature sequence mne-miR-27a

Accession MIMAT0002757
Sequence

51 - 

uucacaguggcuaaguuccgcc

 - 72

Get sequence
Evidence by similarity; MI0000085

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).