Stem-loop sequence mne-mir-19b-1

AccessionMI0003023 (change log)
DescriptionMacaca nemestrina miR-19b-1 stem-loop
Gene family MIPF0000011; mir-19
Stem-loop
        uu                 -  -      uc    ugugu 
5' cacug  cuaugguuaguuuugca gg uuugca  cagc     g
   |||||  ||||||||||||||||| || ||||||  ||||     a
3' gugau  ggugucagucaaaacgu cc aaacgu  gucg     u
        --                 a  u      --    ucuua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Database links

Mature sequence mne-miR-19b

Accession MIMAT0002726
Sequence

54 - 

ugugcaaauccaugcaaaacuga

 - 76

Get sequence
Evidence by similarity; MI0000075

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).