Stem-loop sequence mne-mir-19a

AccessionMI0003021 (change log)
DescriptionMacaca nemestrina miR-19a stem-loop
Gene family MIPF0000011; mir-19
Stem-loop
       u  u                 --      ---    gg 
5' gcag cc cuguuaguuuugcauag  uugcac   uaca  a
   |||| || |||||||||||||||||  ||||||   ||||  a
3' cguc gg gguagucaaaacguauc  aacgug   augu  g
       c  u                 ua      uug    aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Database links

Mature sequence mne-miR-19a

Accession MIMAT0002724
Sequence

49 - 

ugugcaaaucuaugcaaaacuga

 - 71

Get sequence
Evidence by similarity; MI0000073

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).