Stem-loop sequence mne-mir-181b

AccessionMI0002942 (change log)
DescriptionMacaca nemestrina miR-181b stem-loop
Gene family MIPF0000007; mir-181
   ccugugcagagauuauuuuuuaaaa       aucaa         cug          gaa  g 
5'                          ggucaca     cauucauug   ucgguggguu   cu u
                            |||||||     |||||||||   ||||||||||   ||  
3'                          ccggugu     guaaguaac   agucacucga   ga g
   -------------------uucgcc       -caac         --a          aca  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Database links

Mature sequence mne-miR-181b

Accession MIMAT0002635

36 - 


 - 59

Get sequence
Evidence by similarity; MI0000270


PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).