![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ptr-mir-30c-2 |
|||||
Accession | MI0002923 (change log) | ||||
Previous IDs | ptr-mir-30c | ||||
Description | Pan troglodytes miR-30c-2 stem-loop | ||||
Gene family | MIPF0000005; mir-30 | ||||
Literature search |
2 open access papers mention ptr-mir-30c-2 | ||||
Stem-loop |
uacu u aca guggaa 5' aga guaaaca ccu cucucagcu a ||| ||||||| ||| ||||||||| 3' ucu cauuugu gga gagggucga g uucu c --a aagaau |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated. |
||||
Genome context |
|
||||
Database links |
Mature sequence ptr-miR-30c |
|
Accession | MIMAT0002614 |
Sequence |
7 - uguaaacauccuacacucucagc - 29 |
Evidence | by similarity; MI0000736 |
Predicted targets |
|
References |
|
1 |
PMID:15652478
"Phylogenetic shadowing and computational identification of human microRNA genes"
Cell. 120:21-24(2005).
|