Stem-loop sequence mne-mir-197

AccessionMI0002911 (change log)
DescriptionMacaca nemestrina miR-197 stem-loop
Gene family MIPF0000123; mir-197
Stem-loop 
                a       ca    ga   -   a 
5' ggcugugccgggu gagaggg  gugg  ggu aag g
   ||||||||||||| |||||||  ||||  ||| |||  
3' ccgguacggccca cucuucc  cacu  cca uuc c
                c       ac    uc   c   u
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Database links

Mature sequence mne-miR-197

Accession MIMAT0002602
Sequence

48 -  

uucaccaccuucuccacccggc

 - 69

Get sequence
Evidence by similarity; MI0000239

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).