Stem-loop sequence mne-mir-218-2

AccessionMI0002883 (change log)
DescriptionMacaca nemestrina miR-218-2 stem-loop
Gene family MIPF0000026; mir-218
Stem-loop
   gac   --uc  u    g       uuu         cu        gguggaacga  g 
5'    cag    gc gcgg gcuuucc   gugcuugau  aaccaugu          ug a
      |||    || |||| |||||||   |||||||||  ||||||||          ||  
3'    guc    cg ugcc cgaaagg   cacgaacug  uugguaca          gc a
   -ac   cucu  -    a       cgc         uc        --------ag  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Database links

Mature sequence mne-miR-218

Accession MIMAT0002573
Sequence

25 - 

uugugcuugaucuaaccaugu

 - 45

Get sequence
Evidence by similarity; MI0000295

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).