Stem-loop sequence mne-mir-218-1

AccessionMI0002876 (change log)
DescriptionMacaca nemestrina miR-218-1 stem-loop
Gene family MIPF0000026; mir-218
Stem-loop
   -   acaau  a   a   u      u         cu        gg    gag 
5'  gug     gu gcg gau uucugu gugcuugau  aaccaugu  uugc   g
    |||     || ||| ||| |||||| |||||||||  ||||||||  ||||   u
3'  cau     cg cgc cug aaggua cacgaacug  uugguaca  aaug   a
   a   -cuuu  a   a   c      c         cc        -a    agu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Database links

Mature sequence mne-miR-218

Accession MIMAT0002573
Sequence

25 - 

uugugcuugaucuaaccaugu

 - 45

Get sequence
Evidence by similarity; MI0000295

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).