![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mne-mir-211 |
|
Accession | MI0002852 (change log) |
Description | Macaca nemestrina miR-211 stem-loop |
Gene family | MIPF0000042; mir-204 |
Stem-loop |
uca - -----cau uug u ca c agg u 5' cug gc gugac ugggc ucccuuugu uccuu gccu gc c ||| || ||||| ||||| ||||||||| ||||| |||| || u 3' gac cg cacug acucg ggggaaacg aggga cggg cg g -ga a acacccuu uug u ac - --a a |
Confidence |
Annotation confidence: not enough data
|
Comments |
Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated. |
Database links |
|
Mature sequence mne-miR-211 |
|
Accession | MIMAT0002549 |
Sequence |
25 - uucccuuugucauccuucgccu - 46 |
Evidence | by similarity; MI0000287 |
References |
|
1 |
PMID:15652478
"Phylogenetic shadowing and computational identification of human microRNA genes"
Cell. 120:21-24(2005).
|