Stem-loop sequence mne-mir-211

AccessionMI0002852 (change log)
DescriptionMacaca nemestrina miR-211 stem-loop
Gene family MIPF0000042; mir-204
Stem-loop
   uca   -  -----cau     uug     u         ca     c    agg  u 
5'    cug gc        gugac   ugggc ucccuuugu  uccuu gccu   gc c
      ||| ||        |||||   ||||| |||||||||  ||||| ||||   || u
3'    gac cg        cacug   acucg ggggaaacg  aggga cggg   cg g
   -ga   a  acacccuu     uug     u         ac     -    --a  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Database links

Mature sequence mne-miR-211

Accession MIMAT0002549
Sequence

25 - 

uucccuuugucauccuucgccu

 - 46

Get sequence
Evidence by similarity; MI0000287

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).