Stem-loop sequence ptr-mir-199a-2

Accession

MI0002833 (change log)

Previous IDs

ptr-mir-199a

Description

Pan troglodytes miR-199a-2 stem-loop

Gene family

MIPF0000040; mir-199

Literature search

2 open access papers mention ptr-mir-199a-2
(5 sentences)

Stem-loop

   aggaa   u  ggaga    -    c   gcc       u        c   --uca  ac 
5'      gcu cu     uccu gcuc guc   ccagugu cagacuac ugu     gg  a
        ||| ||     |||| |||| |||   ||||||| |||||||| |||     ||   
3'      cga ga     ggga cggg cag   gguuaca gucugaug aca     cc  a
   ----a   -  -----    a    u   auu       c        -   uguug  gu 

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context

• Coordinates (Pan_tro3.0; GCA_000001515.5): chr1: 150507742-150507851 [-]
• Overlapping transcripts:

  antisense

  ENSPTRT00000049851 ; DNM3-201; intron 14

Clustered miRNAs

< 10kb from ptr-mir-199a-2

• ptr-mir-199a-2: chr1: 150507742-150507851 [-]
• ptr-mir-214: chr1: 150502000-150502109 [-]

Database links

• EntrezGene:MIR199A-2
• miRBase Tracker:MI0002833

Mature sequence ptr-miR-199a-5p

• Accession: MIMAT0002530
• Previous IDs: ptr-miR-199a
• Sequence: 31 - cccaguguucagacuaccuguuc - 53
• Evidence: by similarity; MI0000281
• Predicted targets:
  • TargetScanVert:ptr-miR-199a-5p

References

1. PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).