Stem-loop sequence ptr-mir-199a-2

AccessionMI0002833 (change log)
Previous IDsptr-mir-199a
DescriptionPan troglodytes miR-199a-2 stem-loop
Gene family MIPF0000040; mir-199
Literature search

2 open access papers mention ptr-mir-199a-2
(5 sentences)

Stem-loop
   aggaa   u  ggaga    -    c   gcc       u        c   --uca  ac 
5'      gcu cu     uccu gcuc guc   ccagugu cagacuac ugu     gg  a
        ||| ||     |||| |||| |||   ||||||| |||||||| |||     ||   
3'      cga ga     ggga cggg cag   gguuaca gucugaug aca     cc  a
   ----a   -  -----    a    u   auu       c        -   uguug  gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr1: 150507742-150507851 [-]
antisense
ENSPTRT00000049851 ; DNM3-201; intron 14
Clustered miRNAs
< 10kb from ptr-mir-199a-2
ptr-mir-199a-2chr1: 150507742-150507851 [-]
ptr-mir-214chr1: 150502000-150502109 [-]
Database links

Mature sequence ptr-miR-199a-5p

Accession MIMAT0002530
Previous IDsptr-miR-199a
Sequence

31 - 

cccaguguucagacuaccuguuc

 - 53

Get sequence
Evidence by similarity; MI0000281
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).