Stem-loop sequence mne-mir-10b

AccessionMI0002794 (change log)
DescriptionMacaca nemestrina miR-10b stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
   ca      guaa     u        a    g     c          -ug   u 
5'   gagguu    cguug cuauauau cccu uagaa cgaauuugug   gua c
     ||||||    ||||| |||||||| |||| ||||| ||||||||||   |||  
3'   cuucaa    guagc gguauaua gggg aucuu gcuuagacac   uau c
   -a      aaac     u        a    -     a          uga   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Database links

Mature sequence mne-miR-10b

Accession MIMAT0002492
Sequence

26 - 

uacccuguagaaccgaauuugu

 - 47

Get sequence
Evidence by similarity; MI0000267

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).