Stem-loop sequence mne-mir-7-2

AccessionMI0002783 (change log)
DescriptionMacaca nemestrina miR-7-2 stem-loop
Gene family MIPF0000022; mir-7
Stem-loop
   cuggauacagag  a          c    c   a     a u     u       ucuua 
5'             ug aguggcuggc ccgu ugg agacu g gauuu guuguug     c
               || |||||||||| |||| ||| ||||| | ||||| |||||||      
3'             ac uuaccgaccg ggua gcc ucuga c cuaag caacaac     u
   ------------  g          u    a   g     c -     -       ucgcg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Database links

Mature sequence mne-miR-7

Accession MIMAT0002483
Sequence

32 - 

uggaagacuagugauuuuguu

 - 52

Get sequence
Evidence by similarity; MI0000264

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).