Stem-loop sequence mml-mir-124a-1

AccessionMI0002766 (change log)
Previous IDsmml-mir-124a
DescriptionMacaca mulatta miR-124a-1 stem-loop
Gene family MIPF0000021; mir-124
Literature search

1 open access papers mention mml-mir-124a-1
(2 sentences)

Stem-loop 
   a     au   ----         c  cc        a   ga        uaau 
5'  ucaag  cag    aggcucugc cu  guguucac gcg  ccuugauu    g
    |||||  |||    ||||||||| ||  |||||||| |||  ||||||||    u
3'  aguuc  guc    uccgaggcg ga  cguaagug cgc  ggaauuaa    c
   a     ac   ggca         a  ac        g   ac        caua
Get sequence
Deep sequencing
618497 reads, 3.02e+03 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [2]. The expression of this mature miRNA was validated by Miska et al [1].

Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr8: 62428637-62428745 [+]
intergenic
Database links

Mature sequence mml-miR-124a-5p

Accession MIMAT0026585
Sequence

28 -  

guucacagcggaccuugau

 - 46

Get sequence
Deep sequencing2984 reads, 8 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-124a-3p

Accession MIMAT0002470
Sequence

61 -  

uuaaggcacgcggugaaugcca

 - 82

Get sequence
Deep sequencing1233981 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
2
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).