Stem-loop sequence mml-mir-103-1

AccessionMI0002743 (change log)
Previous IDsmml-mir-103
DescriptionMacaca mulatta miR-103-1 stem-loop
Gene family MIPF0000024; mir-103
Literature search

5 open access papers mention mml-mir-103-1
(18 sentences)

Stem-loop 
   uac    c  --    u  u           c   u g a 
5'    ugcc uc  ggcu cu uacagugcugc uug u c u
      |||| ||  |||| || ||||||||||| ||| | |  
3'    acgg ag  ucgg ga auguuacgacg aac a g a
   guu    a  ua    -  c           -   u g u
Get sequence
Deep sequencing
977581 reads, 6.18e+03 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [2]. The expression of this mature miRNA was validated by Miska et al [1].

Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr6: 166809198-166809275 [-]
sense
ENSMMUT00000019827 ; LCP2-201; intron 10
Database links

Mature sequence mml-miR-103-5p

Accession MIMAT0026582
Sequence

9 -  

ucggcuucuuuacagugcugccuug

 - 33

Get sequence
Deep sequencing48 reads, 6 experiments
Evidence experimental; Illumina [3]
Predicted targets

Mature sequence mml-miR-103-3p

Accession MIMAT0002447
Sequence

48 -  

agcagcauuguacagggcuauga

 - 70

Get sequence
Deep sequencing1955038 reads, 9 experiments
Evidence by similarity; MI0000108
Database links
Predicted targets

References

1
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
2
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).