Stem-loop sequence ggo-mir-100

AccessionMI0002709 (change log)
DescriptionGorilla gorilla miR-100 stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
       -uu c    a   cg     c   a      - uau 
5' ccug   g caca acc  uagau cga cuugug g   u
   ||||   | |||| |||  ||||| ||| |||||| |    
3' ggau   c gugu ugg  aucua guu gaacac c   a
       ugu u    a   au     u   c      g cug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chr11: 122251393-122251472 [-]
intergenic
Database links

Mature sequence ggo-miR-100

Accession MIMAT0002417
Sequence

13 - 

aacccguagauccgaacuugug

 - 34

Get sequence
Evidence by similarity; MI0000102

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).