Stem-loop sequence ggo-mir-100

Accession

MI0002709 (change log)

Description

Gorilla gorilla miR-100 stem-loop

Gene family

MIPF0000033; mir-10

Stem-loop

       -uu c    a   cg     c   a      - uau 
5' ccug   g caca acc  uagau cga cuugug g   u
   ||||   | |||| |||  ||||| ||| |||||| |    
3' ggau   c gugu ugg  aucua guu gaacac c   a
       ugu u    a   au     u   c      g cug 

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context

• Coordinates (GorGor4; GCA_000151905.3): chr11: 122251393-122251472 [-]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0002709

Mature sequence ggo-miR-100

• Accession: MIMAT0002417
• Sequence: 13 - aacccguagauccgaacuugug - 34
• Evidence: by similarity; MI0000102

References

1. PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).