Stem-loop sequence ptr-mir-99a

Accession

MI0002703 (change log)

Description

Pan troglodytes miR-99a stem-loop

Gene family

MIPF0000033; mir-10

Stem-loop

   cc          a         uc   u      g  aag 
5'   cauuggcaua acccguaga  cga cuugug ug   u
     |||||||||| |||||||||  ||| |||||| ||    
3'   gugacugugu uggguaucu  gcu gaacac gc   g
   gu          c         uc   c      -  cag 

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context

• Coordinates (Pan_tro3.0; GCA_000001515.5): chr21: 2985749-2985829 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from ptr-mir-99a

• ptr-mir-99a: chr21: 2985749-2985829 [+]
• ptr-let-7c: chr21: 2986489-2986571 [+]

Database links

• EntrezGene:MIR99A
• miRBase Tracker:MI0002703

Mature sequence ptr-miR-99a

• Accession: MIMAT0002411
• Sequence: 13 - aacccguagauccgaucuugug - 34
• Evidence: by similarity; MI0000101
• Predicted targets:
  • TargetScanVert:ptr-miR-99a

References

1. PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).