![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mml-mir-30a |
|||||
Accession | MI0002666 (change log) | ||||
Description | Macaca mulatta miR-30a stem-loop | ||||
Gene family | MIPF0000005; mir-30 | ||||
Literature search |
4 open access papers mention mml-mir-30a | ||||
Stem-loop |
a uc ----- a 5' gcg cuguaaacaucc gacuggaagcu gug a ||| |||||||||||| ||||||||||| ||| 3' cgu gacguuuguagg cugacuuucgg uac g c -- guaga c |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Comments |
Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence mml-miR-30a-5p |
|
Accession | MIMAT0002369 |
Sequence |
6 - uguaaacauccucgacuggaag - 27 |
Deep sequencing | 10951367 reads, 9 experiments |
Evidence | by similarity; MI0000088 |
Database links |
|
Predicted targets |
|
Mature sequence mml-miR-30a-3p |
|
Accession | MIMAT0002370 |
Sequence |
47 - cuuucagucggauguuugcagc - 68 |
Deep sequencing | 778879 reads, 9 experiments |
Evidence | by similarity; MI0000088 |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:15652478
"Phylogenetic shadowing and computational identification of human microRNA genes"
Cell. 120:21-24(2005).
|