![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mne-mir-29a |
|
Accession | MI0002665 (change log) |
Description | Macaca nemestrina miR-29a stem-loop |
Gene family | MIPF0000009; mir-29 |
Stem-loop |
uuu c ucaa 5' augacugauuuc ugguguu agag u |||||||||||| ||||||| |||| a 3' uauuggcuaaag accacga ucuu u ucu - uuaa |
Confidence |
Annotation confidence: not enough data
|
Comments |
Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated. |
Database links |
|
Mature sequence mne-miR-29a |
|
Accession | MIMAT0002368 |
Sequence |
41 - cuagcaccaucugaaaucgguu - 62 |
Evidence | by similarity; MI0000087 |
References |
|
1 |
PMID:15652478
"Phylogenetic shadowing and computational identification of human microRNA genes"
Cell. 120:21-24(2005).
|