Stem-loop sequence mne-mir-24-1

AccessionMI0002639 (change log)
DescriptionMacaca nemestrina miR-24-1 stem-loop
Gene family MIPF0000041; mir-24
Stem-loop
       g  g   a         ua     ucuca 
5' cucc gu ccu cugagcuga  ucagu     u
   |||| || ||| |||||||||  |||||     u
3' gagg ca gga gacuugacu  gguca     u
       a  a   c         -c     cacau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Database links

Mature sequence mne-miR-24-5p

Accession MIMAT0002340
Previous IDsmne-miR-189;mne-miR-24*
Sequence

6 - 

gugccuacugagcugauaucagu

 - 28

Get sequence
Evidence by similarity; MI0000080

Mature sequence mne-miR-24-3p

Accession MIMAT0002341
Previous IDsmne-miR-24
Sequence

44 - 

uggcucaguucagcaggaacag

 - 65

Get sequence
Evidence by similarity; MI0000081

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).