Stem-loop sequence mne-mir-22

AccessionMI0002636 (change log)
DescriptionMacaca nemestrina miR-22 stem-loop
Gene family MIPF0000053; mir-22
Stem-loop
      u   cc               -     a      u  ccu 
5' ggc gag  gcaguaguucuucag uggca gcuuua gu   g
   ||| |||  ||||||||||||||| ||||| |||||| ||   a
3' ccg cuc  cguugucaagaaguu accgu cgaaau cg   c
      u   -c               g     -      -  acc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Database links

Mature sequence mne-miR-22

Accession MIMAT0002335
Sequence

53 - 

aagcugccaguugaagaacugu

 - 74

Get sequence
Evidence by similarity; MI0000078

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).