Stem-loop sequence mne-mir-184

AccessionMI0002604 (change log)
DescriptionMacaca nemestrina miR-184 stem-loop
Gene family MIPF0000059; mir-184
Stem-loop
           g c         c      a c     -     g 
5' ucagucac u cccuuauca uuuucc g ccagc uuuau a
   |||||||| | ||||||||| |||||| | ||||| |||||  
3' aguuagug a gggaauagu aagagg c gguug gaaug c
           g u         c      - a     u     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Database links

Mature sequence mne-miR-184

Accession MIMAT0002303
Sequence

53 - 

uggacggagaacugauaagggu

 - 74

Get sequence
Evidence by similarity; MI0000481

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).