Stem-loop sequence ssc-mir-29c

AccessionMI0002460 (change log)
DescriptionSus scrofa miR-29c stem-loop
Gene family MIPF0000009; mir-29
Literature search

30 open access papers mention ssc-mir-29c
(65 sentences)

Stem-loop 
   a         -  ggc           ucc       ---     u 
5'  ucucuuaca ca   ugaccgauuuc   ugguguu   cagag c
    ||||||||| ||   |||||||||||   |||||||   ||||| u
3'  gggggaugu gu   auuggcuaaag   accacga   guuuu g
   a         a  ---           uuu       ucu     u
Get sequence
Deep sequencing
2832 reads, 320 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr9: 148552997-148553084 [+]
intergenic
Clustered miRNAs
< 10kb from ssc-mir-29c
ssc-mir-29b-2chr9: 148552438-148552521 [+]
ssc-mir-29cchr9: 148552997-148553084 [+]
Database links

Mature sequence ssc-miR-29c

Accession MIMAT0002166
Sequence

54 -  

uagcaccauuugaaaucgguua

 - 75

Get sequence
Deep sequencing2487 reads, 15 experiments
Evidence experimental; cloned [2], Illumina [3-4]

References

1
PMID:15885146 "Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing" Wernersson R, Schierup MH, Jorgensen FG, Gorodkin J, Panitz F, Staerfeldt HH, Christensen OF, Mailund T, Hornshoj H, Klein A, Wang J, Liu B, Hu S, Dong W, Li W, Wong GK, Yu J, Wang J, Bendixen C, Fredholm M, Brunak S, Yang H, Bolund L BMC Genomics. 6:70(2005).
2
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
3
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
4
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).