Stem-loop sequence ssc-mir-107

Accession

MI0002449 (change log)

Description

Sus scrofa miR-107 stem-loop

Gene family

MIPF0000024; mir-103

Literature search

11 open access papers mention ssc-mir-107
(33 sentences)

Stem-loop

   -      c      --c    u  u           c   u   a 
5'  uucucu ugcuuu   agcu cu uacaguguugc uug ggc u
    |||||| ||||||   |||| || ||||||||||| ||| ||| g
3'  gagaga acgaaa   ucgg ga auguuacgacg aac uug g
   c      c      cua    -  c           -   -   a 

Deep sequencing

17799 reads, 1.07e+04 reads per million, 16 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Sscrofa10.2; GCA_000003025.4): chr14: 110407095-110407181 [-]
• Overlapping transcripts:

  sense

  ENSSSCT00000011442 ; PANK1-201; intron 6

Database links

• EntrezGene:MIR107
• miRBase Tracker:MI0002449

Mature sequence ssc-miR-107

• Accession: MIMAT0002155
• Sequence: 52 - agcagcauuguacagggcuauca - 74
• Deep sequencing: 17786 reads, 15 experiments
• Evidence: experimental; cloned [2], 454 [3], Illumina [4-6]

References

1. PMID:15885146 "Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing" Wernersson R, Schierup MH, Jorgensen FG, Gorodkin J, Panitz F, Staerfeldt HH, Christensen OF, Mailund T, Hornshoj H, Klein A, Wang J, Liu B, Hu S, Dong W, Li W, Wong GK, Yu J, Wang J, Bendixen C, Fredholm M, Brunak S, Yang H, Bolund L BMC Genomics. 6:70(2005).
2. PMID:18548309 "Identification and characterization of new microRNAs from pig" Kim J, Cho IS, Hong JS, Choi YK, Kim H, Lee YS Mamm Genome. 19:570-580(2008).
3. PMID:19196471 "Cloning, characterization and expression analysis of porcine microRNAs" Reddy AM, Zheng Y, Jagadeeswaran G, Macmil SL, Graham WB, Roe BA, Desilva U, Zhang W, Sunkar R BMC Genomics. 10:65(2009).
4. PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
5. PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
6. PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).