![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ssc-mir-107 |
|||||
Accession | MI0002449 (change log) | ||||
Description | Sus scrofa miR-107 stem-loop | ||||
Gene family | MIPF0000024; mir-103 | ||||
Literature search |
![]()
11 open access papers mention ssc-mir-107 | ||||
Stem-loop |
- c --c u u c u a 5' uucucu ugcuuu agcu cu uacaguguugc uug ggc u |||||| |||||| |||| || ||||||||||| ||| ||| g 3' gagaga acgaaa ucgg ga auguuacgacg aac uug g c c cua - c - - a |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
Mature sequence ssc-miR-107 |
|
Accession | MIMAT0002155 |
Sequence |
52 - agcagcauuguacagggcuauca - 74 |
Deep sequencing | 17786 reads, 15 experiments |
Evidence | experimental; cloned [2], 454 [3], Illumina [4-6] |
References |
|
1 |
PMID:15885146
"Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing"
BMC Genomics. 6:70(2005).
|
2 |
PMID:18548309
"Identification and characterization of new microRNAs from pig"
Mamm Genome. 19:570-580(2008).
|
3 |
PMID:19196471
"Cloning, characterization and expression analysis of porcine microRNAs"
BMC Genomics. 10:65(2009).
|
4 |
PMID:19917043
"MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing"
Anim Genet. 41:159-168(2010).
|
5 |
PMID:21312241
"MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing"
J Cell Biochem. 112:1318-1328(2011).
|
6 |
PMID:24499489
"Exploration of microRNAs in porcine milk exosomes"
BMC Genomics. 15:100(2014).
|