Stem-loop sequence ssc-mir-27a

AccessionMI0002442 (change log)
DescriptionSus scrofa miR-27a stem-loop
Gene family MIPF0000036; mir-27
Literature search

25 open access papers mention ssc-mir-27a
(73 sentences)

Stem-loop 
   ugg  u    a  a         ug  u       g u cac 
5'    cc gggg gc gggcuuagc  cu gugagca g c   a
      || |||| || |||||||||  || ||||||| | |    
3'    gg cccc cg cuugaaucg  ga cacuugu c g   g
   --a  u    -  c         gu  -       g u aac
Get sequence
Deep sequencing
79129 reads, 1.45e+04 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr2: 65582015-65582096 [+]
intergenic
Clustered miRNAs
< 10kb from ssc-mir-27a
ssc-mir-23achr2: 65581838-65581907 [+]
ssc-mir-27achr2: 65582015-65582096 [+]
ssc-mir-24-1chr2: 65582174-65582245 [+]
Database links

Mature sequence ssc-miR-27a

Accession MIMAT0002148
Sequence

54 -  

uucacaguggcuaaguuccgc

 - 74

Get sequence
Deep sequencing79047 reads, 15 experiments
Evidence experimental; cloned [2], Illumina [3-4]

References

1
PMID:15885146 "Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing" Wernersson R, Schierup MH, Jorgensen FG, Gorodkin J, Panitz F, Staerfeldt HH, Christensen OF, Mailund T, Hornshoj H, Klein A, Wang J, Liu B, Hu S, Dong W, Li W, Wong GK, Yu J, Wang J, Bendixen C, Fredholm M, Brunak S, Yang H, Bolund L BMC Genomics. 6:70(2005).
2
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
3
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
4
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).