Stem-loop sequence ssc-mir-145

Accession

MI0002417 (change log)

Description

Sus scrofa miR-145 stem-loop

Gene family

MIPF0000079; mir-145

Literature search

24 open access papers mention ssc-mir-145
(62 sentences)

Stem-loop

   ca  u  u     c  uc    u  c            uagau 
5'   cc ug ccuca gg  cagu uu ccaggaaucccu     g
     || || ||||| ||  |||| || ||||||||||||     c
3'   gg ac ggagu uc  guca aa gguccuuagggg     u
   --  u  u     -  uu    u  a            uagag 

Deep sequencing

106804 reads, 3.17e+04 reads per million, 15 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Sscrofa10.2; GCA_000003025.4): chr2: 157346127-157346212 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from ssc-mir-145

• ssc-mir-143: chr2: 157344738-157344817 [+]
• ssc-mir-145: chr2: 157346127-157346212 [+]

Database links

• EntrezGene:MIR145
• miRBase Tracker:MI0002417

Mature sequence ssc-miR-145-5p

• Accession: MIMAT0002123
• Previous IDs: ssc-miR-145
• Sequence: 16 - guccaguuuucccaggaaucccuu - 39
• Deep sequencing: 89125 reads, 15 experiments
• Evidence: experimental; cloned [2,4], Illumina [3,5-6]

Mature sequence ssc-miR-145-3p

• Accession: MIMAT0022919
• Sequence: 54 - ggauuccuggaaauacuguucu - 75
• Deep sequencing: 17676 reads, 15 experiments
• Evidence: experimental; Illumina [5]

References

1. PMID:15885146 "Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing" Wernersson R, Schierup MH, Jorgensen FG, Gorodkin J, Panitz F, Staerfeldt HH, Christensen OF, Mailund T, Hornshoj H, Klein A, Wang J, Liu B, Hu S, Dong W, Li W, Wong GK, Yu J, Wang J, Bendixen C, Fredholm M, Brunak S, Yang H, Bolund L BMC Genomics. 6:70(2005).
2. PMID:18548309 "Identification and characterization of new microRNAs from pig" Kim J, Cho IS, Hong JS, Choi YK, Kim H, Lee YS Mamm Genome. 19:570-580(2008).
3. PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
4. PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
5. PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
6. PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).