![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ath-MIR447a |
||||||||
Accession | MI0002407 (change log) | |||||||
Description | Arabidopsis thaliana miR447a stem-loop | |||||||
Gene family | MIPF0000170; MIR447 | |||||||
Literature search |
![]()
4 open access papers mention ath-MIR447a | |||||||
Stem-loop |
ua uu a u a aca a - ug u cgagcuugguguuuuuuucuagccaacucc 5' cauucu auauauaauacuac uuuc uccau aa ccccuu augucgagu aacgaagcaucu gucccc gua ugucuu a |||||| |||||||||||||| |||| ||||| || |||||| ||||||||| |||||||||||| |||||| ||| |||||| 3' gugaga uauauauuaugaug aaag aggua uu ggggaa uauagcuca uuguuuuguaga cagggg uau acagag a gc uu a u c gaa g g uu u uucuuauguuuguuacuaguugagcucuug |
|||||||
Confidence |
Annotation confidence: not enough data
| |||||||
Genome context |
|
|||||||
Clustered miRNAs |
|
|||||||
Database links |
|
Mature sequence ath-miR447a-3p |
|
Accession | MIMAT0002113 |
Previous IDs | ath-miR447a |
Sequence |
160 - uuggggacgagauguuuuguug - 181 |
Evidence | experimental; cloned [1-2], 5'RACE [2], 454 [3], Illumina [4] |
Mature sequence ath-miR447a.2-3p |
|
Accession | MIMAT0020345 |
Previous IDs | ath-miR447a.2 |
Sequence |
203 - uauggaagaaauuguaguauu - 223 |
Evidence | experimental; Illumina [5] |
References |
|
1 |
PMID:15851028
"microRNA-directed phasing during trans-acting siRNA biogenesis in plants"
Cell. 121:207-221(2005).
|
2 |
PMID:16040653
"Expression of Arabidopsis MIRNA genes"
Plant Physiol. 138:2145-2154(2005).
|
3 |
PMID:17182867
"A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"
Genes Dev. 20:3407-3425(2006).
|
4 |
PMID:19815687
"Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis"
J Exp Bot. 61:165-177(2010).
|
5 |
PMID:21357774
"MicroRNA activity in the Arabidopsis male germline"
J Exp Bot. 62:1611-1620(2011).
|