miRBase entry: mmu-mir-470

Stem-loop mmu-mir-470


Accession
MI0002405
Symbol
MGI: Mir470
Description
Mus musculus mmu-mir-470 precursor miRNA
Gene family
MIPF0000386; mir-743

Literature search
11 open access papers mention mmu-mir-470
(20 sentences)

Sequence

202579 reads, 4587 reads per million, 51 experiments
cagugcucUUCUUGGACUGGCACUGGUGAGUuaaacuaaauacAACCAGUACCUUUCUGAGAAGAguaaagcuca
...(((((((((((((..((.((((((..((..........)).)))))).))..))))))))))))).......

Structure
----cag             CU  C      GA  uaaa 
       ugcucUUCUUGGA  GG ACUGGU  GU    c
       |||||||||||||  || ||||||  ||     
       augAGAAGAGUCU  CC UGACCA  ca    u
acucgaa             UU  A      -A  uaaa 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
chrX: 66813951-66814025 [-]
Clustered miRNAs
2 other miRNAs are < 10 kb from mmu-mir-470
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-470-5p

Accession MIMAT0002111
Description Mus musculus mmu-miR-470-5p mature miRNA
Sequence 9 - UUCUUGGACUGGCACUGGUGAGU - 31
Evidence experimental
cloned [1-3], Illumina [4-5]
Database links
Predicted targets

Mature mmu-miR-470-3p

Accession MIMAT0004760
Description Mus musculus mmu-miR-470-3p mature miRNA
Sequence 44 - AACCAGUACCUUUCUGAGAAGA - 65
Evidence experimental
cloned [3], Illumina [4-5]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16766679
    Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
    "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
    "Genes Dev (2006) 20:1732-1743

  3. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  4. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  5. PubMed ID: 15901636
    MicroRNA Mirn122a reduces expression of the posttranscriptionally regulated germ cell transition protein 2 (Tnp2) messenger RNA (mRNA) by mRNA cleavage
    "Yu Z, Raabe T, Hecht NB"
    "Biol Reprod (2005) 73:427-433