Stem-loop sequence ptc-MIR480

AccessionMI0002390 (change log)
DescriptionPopulus trichocarpa miR480 stem-loop
Stem-loop
   uaa    -  ug g  ug  ccu   -u     auaauagacccacaccugacugcuuagaauuauuuguu 
5'    uaug uu  g gu  au   ugu  uaguu                                      a
      |||| ||  | ||  ||   |||  |||||                                       
3'    auac aa  u ca  ua   aca  aucaa                                      u
   -aa    c  gu g  gu  -cu   uc     gagacaaaaaguugcaguuauuacaucagccuauacgc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000350.2: 7250847-7250986 [-]
intergenic
Database links

Mature sequence ptc-miR480

Accession MIMAT0002096
Sequence

111 - 

acuacuacaucauugacguugaac

 - 134

Get sequence
Evidence experimental; cloned [1], PCR [1]

References

1
PMID:15994906 "Novel and mechanical stress-responsive MicroRNAs in Populus trichocarpa that are absent from Arabidopsis" Lu S, Sun YH, Shi R, Clark C, Li L, Chiang VL Plant Cell. 17:2186-2203(2005).