Dead miRNA entry

miRNA accession:
MI0002340
miRNA ID:
ptc-MIR399c
Forward to:
MI0002339
Comment:
Two identical MIR399 sequences in miRBase 19 map to only one locus in the JGI v2 genome assembly. The entries are therefore merged in miRBase 20.

Previous miRNA entry

Stem-loop sequence ptc-MIR399c

AccessionMI0002340 (change log)
DescriptionPopulus trichocarpa miR399c stem-loop
Stem-loop
   ggugc      auuaca       c    a        ca   acuaagacacgcaauaucuaac 
5'      aguugc      gggcaag uucc uuggcaug  gcc                      a
        ||||||      ||||||| |||| ||||||||  |||                       
3'      uuaacg      cccguuu gagg aaccguac  cgg                      c
   -cuuc      -----g       a    a        cg   cgugagauguccuuacguaguu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000340.2: 4642730-4642823 [+]
intergenic
Clustered miRNAs
< 10kb from ptc-MIR399c
ptc-MIR399bCM000340.2: 4636054-4636179 [+]
ptc-MIR399gCM000340.2: 4640161-4640254 [-]
ptc-MIR399cCM000340.2: 4642730-4642823 [+]
Database links