Stem-loop sequence dre-mir-455-1

Accession

MI0002077 (change log)

Previous IDs

dre-mir-455a

Description

Danio rerio miR-455-1 stem-loop

Gene family

MIPF0000129; mir-455

Literature search

1 open access papers mention dre-mir-455-1
(1 sentences)

Stem-loop

   ---ucc  -   -g     -----          u      a   c   gaa 
5'       cu ggu  ugagg     guaugugccc uggacu cau gug   g
         || |||  |||||     |||||||||| |||||| ||| |||    
3'       ga ccg  acucc     cauauacggg accuga gua cac   c
   cuucua  u   ga     guuca          u      c   c   gac 

Deep sequencing

6634 reads, 218 reads per million, 11 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

The mir-455 precursor was predicted computationally and a mature product verified in human by Northern blot [2]. The precise sequence termini of the mature form were derived by cloning from human and rat samples (Landgraf and Tuschl, unpublished).

Genome context

Coordinates (GRCz11; GCA_000002035.4)	Overlapping transcripts
chr5: 65250379-65250474 [-]	sense OTTDART00000023198 ; si:ch211-233f10.5-001; intron 3 ENSDART00000137363 ; col27a1b-001; intron 3 ENSDART00000097297 ; col27a1b-201; intron 8
KZ115158.1: 169526-169621 [-]	sense OTTDART00000023198 ; si:ch211-233f10.5-001; intron 3 ENSDART00000137363 ; col27a1b-001; intron 3 ENSDART00000097297 ; col27a1b-201; intron 8

Database links

• EntrezGene:mir455
• EntrezGene:mir455
• RNAcentral:URS000075EBBB_7955
• miRBase Tracker:MI0002077

Mature sequence dre-miR-455-5p

• Accession: MIMAT0001879
• Previous IDs: dre-miR-455a
• Sequence: 16 - uaugugcccuuggacuacaucg - 37
• Deep sequencing: 3864 reads, 11 experiments
• Evidence: by similarity; MI0003513
• Database links:
  • RNAcentral:URS00004BBAB0_7955
• Predicted targets:
  • TargetScanFish:dre-miR-455

Mature sequence dre-miR-455-3p

• Accession: MIMAT0031993
• Sequence: 52 - augcaguccaugggcauauacac - 74
• Deep sequencing: 5541 reads, 11 experiments
• Evidence: not experimental

References

1. PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).
2. PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).