Stem-loop sequence sbi-MIR156e

AccessionMI0001856 (change log)
DescriptionSorghum bicolor miR156e stem-loop
Gene family MIPF0000008; MIR156
Literature search

8 open access papers mention sbi-MIR156e
(22 sentences)

Stem-loop
   cga     c cu  -    au        -    -        c     c  c   c      g 
5'    uuagg c  ga agag  ugacagaa gaga gcgagcac cggcg gg ggc ggcaug a
      ||||| |  || ||||  |||||||| |||| |||||||| ||||| || ||| |||||| g
3'    ggucc g  cu ucuc  acugucuu cucu cgcucgug gccgc cc cug ccguac c
   --g     u cu  c    cg        u    u        c     -  -   -      g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr10: 55313871-55313993 [+]
intergenic
Database links

Mature sequence sbi-miR156e

Accession MIMAT0001758
Sequence

21 - 

ugacagaagagagcgagcac

 - 40

Get sequence
Evidence by similarity; MI0001504

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).