Stem-loop sequence sbi-MIR171f

AccessionMI0001854 (change log)
DescriptionSorghum bicolor miR171f stem-loop
Gene family MIPF0000104; MIR171_2
Literature search

2 open access papers mention sbi-MIR171f
(2 sentences)

Stem-loop
   ugaga    -    cg      c         u          -  aua  c       gug 
5'      gaau aaga  acaugg gugauguug uucggcucau gc   uc uucuuga   u
        |||| ||||  |||||| ||||||||| |||||||||| ||   || |||||||    
3'      cuua uucu  uguacu cacuauaac aagccgagua cg   ag aaggacu   a
   --aua    c    ua      -         c          g  --g  a       acu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr4: 62745972-62746090 [-]
intergenic
Database links

Mature sequence sbi-miR171f

Accession MIMAT0001756
Sequence

80 - 

augagccgaaccaauaucacu

 - 100

Get sequence
Evidence by similarity; MI0001147

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).