Stem-loop sequence sbi-MIR159b

AccessionMI0001851 (change log)
DescriptionSorghum bicolor miR159b stem-loop
Gene family MIPF0000010; MIR159
Literature search

2 open access papers mention sbi-MIR159b
(2 sentences)

Stem-loop
   ugaaugaagauaugaagaagaagacgacgacgaugaagaaggcgaagaaaagcgaacaaa                  uc  g         ----    c    g  g  g    u     g      -cucu       caa   - u 
5'                                                             gagcucccuucgauccaa  ca gaggggaag    uggu gguu ca cu ccgg ucaug augccu     ggugcag   uga c g
                                                               ||||||||||||||||||  || |||||||||    |||| |||| || || |||| ||||| ||||||     |||||||   ||| |  
3'                                                             cucgagggaaguuagguu  gu cucccuuuc    acca ccaa gu ga ggcc aguac uguggg     ucacguc   acu g a
   ---------------------------------------cucuuucucucuuucucucuc                  -c  g         uacu    c    -  a  g    c     g      uacgu       --c   c u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr3: 1229688-1229940 [-]
intergenic
Database links

Mature sequence sbi-miR159b

Accession MIMAT0001753
Sequence

214 - 

cuuggauugaagggagcuccu

 - 234

Get sequence
Evidence by similarity; MI0001097

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).