Stem-loop sequence sbi-MIR399h

AccessionMI0001849 (change log)
DescriptionSorghum bicolor miR399h stem-loop
Gene family MIPF0000015; MIR399
Literature search

3 open access papers mention sbi-MIR399h
(5 sentences)

Stem-loop
   aguguu      ----aa    ca   u           c     u   -   caac     ---ag     g 
5'       cagggu      gaau  cag gcgguucuccu uggca gga ggc    auagc     gcauu g
         ||||||      ||||  ||| ||||||||||| ||||| ||| |||    |||||     |||||  
3'       guccca      cuua  guc cguuaagagga accgu ccu ccg    uaucg     cguaa a
   -----g      auaugg    cc   c           a     c   a   ---c     cgaca     g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr10: 48189611-48189742 [+]
intergenic
Clustered miRNAs
< 10kb from sbi-MIR399h
sbi-MIR399fchr10: 48187250-48187369 [-]
sbi-MIR399hchr10: 48189611-48189742 [+]
Database links

Mature sequence sbi-miR399h

Accession MIMAT0001751
Sequence

93 - 

ugccaaaggagaauugcccug

 - 113

Get sequence
Evidence by similarity; MI0001054

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).