Stem-loop sequence sof-MIR408e

AccessionMI0001769 (change log)
DescriptionSaccharum officinarum miR408e stem-loop
Gene family MIPF0000102; MIR408
Literature search

9 open access papers mention sof-MIR408e
(90 sentences)

Stem-loop
   agaagau     -    -u    a      u   g   a   u    -ug    cau     aa  uu   auuucuguccuccgcuaggccgcuacugcauuuauguuugcuugcucacaaaacggagggauuugugagaguua 
5'        gggua uggu  ggag caggga gag cag gca ggga   aggc   caaca  au  cca                                                                          u
          ||||| ||||  |||| |||||| ||| ||| ||| ||||   ||||   |||||  ||  |||                                                                           
3'        cccgu gcca  ccuc gucccu cuc guc cgu cccu   uucg   guugu  ug  ggu                                                                          c
   ---cguu     u    cc    g      u   a   a   -    uca    -uu     cc  -u   cgacucgagaguaggcagaguccaguccgguaguggugaaguggucccuccguggaagaaacaagaaagacgga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence sof-miR408e

Accession MIMAT0001671
Sequence

244 - 

cugcacugacucuucccuggc

 - 264

Get sequence
Evidence by similarity; MI0001149

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).